Et tu Brutus Puzzle Updates | Sevens.exposed Defcon 2017 Cicada 3301

We have made some progress in the Defcon 2017 Cicada 3301 puzzle line that has just started We have seemed to have found the starting point of the puzzle. Now we are working to figure out what is hidden in the DC.fastq file.

Enigma
LPFUDZUTUCVLMVMFCSTUDXURBMZAICMJWUXFCNLYOWZLSGSSWDQLWDEBWCSIXBHPMLLKABISBZCCYUEMXWVUMMSOGRCSASGEAISVYOHRZKBSAKOSDHRCJQCWPSISGGFTSMENJJGYDYIVQMGRWOKSARMCEGZJPPCUCMOJVBNAMNOLONXTHKXWEGEZHYBSNQNENRSEOXGVJWFJWVIPBVIKKZLZBESPBEJQAKSHOMHLKFDYMEYUGMHULHEBMGOFDPKBAZBSGGXQKYWARSDMSGXHDHSURWSAMSZO

DNA
TAGGTTGGTTTGTATTTTACACTTACAGTTGGTTAATAGGTAAGTATCTTGTTTTATTACTATTTACATATTACAGTATTACAGACTGTTTATATTTACGTAGGTATCTTTCTTTTTTTATAGGTTACTAGGTTTGACTTTATCTATCTACTACAGTTGGTTAATAGGTTTTTATCTTACTTTCTTTATAGCTAGCTATTTTGGTATTACAGACAGTTACTTAGTTAATAGGTAGATATTTACCTTTGTAGGTTACTACATATGTTTCTTTGTAACTTAATAGTACCT

Puzzle start
http://bit.ly/2uDVVIT

Second Layer
sevens.exposed/ettubrutus/DC.fastq

Ettubrutus Page Source
http://bit.ly/2vDKTRg

Op Defon Paste
http://bit.ly/2uE0QcJ

Cicada 3301 Tools
http://bit.ly/2vDmw68

Leave a Reply

Your email address will not be published. Required fields are marked *